![]() TTGTTTCTCTACCAGATTTCTTCACTTTTGACAAACAACCCCTAGAATACAGACTATC TTGCTTTACCCCTGGTCCGCGACAAAAAAGACACACATGCGAGCTTTCGAACCTCAGATGCTAATCACACATTACTTGCCTCĬTAAAAAGTTTTCGTTTGAACTTTTCCAAAAGCTTCCTCATTAACGATCCCAATACAACAGAT TTGTCGCGGACCAGGGGTAAAGCAATTGATGGTGCATTGCCTTC TTAACGGTCCCTGCTGCGCTGGCTGAGCAGCGTCTCTGCATGATTGATCCCAATACAACAGATĪATAGGACAACCGATCGTTACTATCAGAGGTAAATACGTTGGAAGAATATATATAAGGTGAAAAACACACATTACTTGCCTCĬTATTTGGAAATACCAAATTCTTCGTATAAAGTATCACCTAATCTGATCCCAATACAACAGATĬAAGACGGTGCATTTCTGGGCTCCTACTTTGAAATGGGGTCTGG GTGATCATTTCTGTATAAGTTTTCTCAACTGAATATATAAATATATATCATTACTATGCTĪTATGTGTTGAGTTTATGCTATGATTCTTTTTAAAGAATTCTATTATTAAAAGGATTAGGĪATTCTTTAAAAAGAATCATAGCATAAACTCAACACATATTGATTACAATTTTTTTCTTCCTTTGTACTATGTATACCAACACACATTACTTGCCTC TTATTCATATTTCATTTTGGACAATGGGGCATCGGGGCCTAAGTAGATCCCAATACAACAGAT Table of expected sizes of the products produced for the 11 ORFS. Tests on PCR2 for YMR272C excluding the primers (including just the forward primer (F), including just the reverse primer (R), including both primers (F+R), including no primers (NP) showed that both primers were needed to produce any product. Tests on PCR2 for YMR272C to vary the extension time showed that the larger product was still evident despite reduced extension time.įigure S7. This additional product was seen on several gels, including the two given here.įigure S6. In addition to products of the expected size (approx 1.25 kb), PCR2 gave an additional product approximately double the expected size (approx 2.5 kb). Replacement PCR2 primers were designed for YGR125W and YGL202W using the new improved method, and they gave the expected PCR2 product without apparent dimer production.įigures S5a and S5b. The reverse primer is used in lanes 26, 27, 29 and all show far more dimer than the neighbouring lanes that did not have the reverse primer.įigure S4. This gel shows the problem for YGR125W and demonstrates that the reverse primer is at fault. ![]() When testing the primers selected on the basis of these initial criteria, PCR2 failed for the ORF YGR125W and electrophoretic analysis indicated primer dimer formation that had not been predicted. Occasionally, even when PCR1 was successful at a 10:1 primer ratio, the PCR3 amplification produced further amplification of PCR1 and PCR2 products, presumably caused by failure of the SOEing reaction during the first 10 cycles of PCR3.įigure S3. The expected product was still obtained in PCR3 but sometimes with further amplification of the PCR1 and PCR2 products. This gel shows the contrasting situation where equimolar amounts of primers are used for PCR1. Lanes 2, 3 and 9 show poor amplification.įigure S2. This can be seen in the lanes numbered 1-11. For example, when a 10:1 ratio of primers (forward:reverse) was employed in PCR1, only eight of the initial 11 ORFS amplified well. Alternative primer ratios might have proven effective, but this was not explored further. Although amplification in PCR1 was good when equimolar amounts of the forward and reverse primers were used, the amplification product was sometimes weak or not visible when a 10:1 ratio of primers was employed. Other lanes on this gel show PCR2 results, and are discussed later. This gel demonstrates PCR1 products for the initial 11 ORFs in lanes 1-11 when a 10:1 ratio of primers (forward:reverse) was employed. ![]()
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |